Dokdonella koreensis: I596_971 Help Entry I596_971          CDS       T04377                                  Name (GenBank) Hypothetical protein   KO K09892   cell division protein ZapB Organism dko  Dokdonella koreensis Brite KEGG Orthology (KO) [BR:dko00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:dko03036]     I596_971 Chromosome and associated proteins [BR:dko03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     I596_971 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB GAS Taxilin DUF7491 FAZ1_C MtrF YabA EMP24_GP25L DUF2203 DUF2721 Motif Other DBs NCBI-ProteinID:  ANB17001 UniProt:  A0A160DSV7 LinkDB All DBs Position complement(1156986..1157204) Genome browser AA seq 72 aa AA seqDB search MSGSEPAIAQLTEITERVDRLVELCRRLSEENRVLRQSQEHLATERAQLLARNEQARSRV EAMILRLKSLEQ NT seq 219 nt NT seq  +upstreamnt  +downstreamnt atgtcgggctccgaaccagccatcgcgcaactgaccgagatcaccgaacgggtcgatcgc ctggtcgagctgtgccggcgcctgagcgaggaaaaccgcgtcctgcgccagagccaggaa cacctggccaccgaacgcgcgcaactgctcgcccgcaacgaacaggcccgcagccgggtc gaggcgatgatcctgcgcctgaagtcgctggaacagtaa

DBGET integrated database retrieval system