Delphinapterus leucas (beluga whale): 111165335 Help Entry 111165335         CDS       T05885                                  Name (RefSeq) metallothionein-2A   KO K14739   metallothionein 1/2 Organism dle  Delphinapterus leucas (beluga whale) Pathway dle04978   Mineral absorption Brite KEGG Orthology (KO) [BR:dle00001]  09150 Organismal Systems   09154 Digestive system    04978 Mineral absorption     111165335  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:dle03019]     111165335    03029 Mitochondrial biogenesis [BR:dle03029]     111165335 Messenger RNA biogenesis [BR:dle03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      111165335 Mitochondrial biogenesis [BR:dle03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     111165335 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  111165335 NCBI-ProteinID:  XP_022411619 UniProt:  A0A2Y9LPG7 LinkDB All DBs Position Unknown AA seq 61 aa AA seqDB search MDPNCSCTAGGSCTCAGSCKCKDCKCTSCKKSCCSCCPPGCAKCAQGCICKGTSDKCSCC A NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggatcccaactgctcctgcaccgcaggcggatcctgcacgtgtgccggctcctgcaaa tgcaaagactgcaaatgcacctcctgcaagaagagctgctgctcctgctgccctccgggc tgcgccaagtgtgcccagggctgcatctgcaaagggacctcagacaagtgcagctgttgt gcctga

DBGET integrated database retrieval system