Entry |
|
Symbol |
GNG8
|
Name |
(RefSeq) guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-8
|
KO |
K04544 | guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-8 |
|
Organism |
dnm Dasypus novemcinctus (nine-banded armadillo)
|
Pathway |
dnm04723 | Retrograde endocannabinoid signaling |
dnm05163 | Human cytomegalovirus infection |
dnm05167 | Kaposi sarcoma-associated herpesvirus infection |
dnm05170 | Human immunodeficiency virus 1 infection |
|
Brite |
KEGG Orthology (KO) [BR:dnm00001]
09130 Environmental Information Processing
09132 Signal transduction
04014 Ras signaling pathway
111763551 (GNG8)
04371 Apelin signaling pathway
111763551 (GNG8)
04151 PI3K-Akt signaling pathway
111763551 (GNG8)
09133 Signaling molecules and interaction
04082 Neuroactive ligand signaling
111763551 (GNG8)
04081 Hormone signaling
111763551 (GNG8)
09150 Organismal Systems
09151 Immune system
04062 Chemokine signaling pathway
111763551 (GNG8)
09152 Endocrine system
04926 Relaxin signaling pathway
111763551 (GNG8)
09156 Nervous system
04724 Glutamatergic synapse
111763551 (GNG8)
04727 GABAergic synapse
111763551 (GNG8)
04725 Cholinergic synapse
111763551 (GNG8)
04728 Dopaminergic synapse
111763551 (GNG8)
04726 Serotonergic synapse
111763551 (GNG8)
04723 Retrograde endocannabinoid signaling
111763551 (GNG8)
09159 Environmental adaptation
04713 Circadian entrainment
111763551 (GNG8)
09160 Human Diseases
09161 Cancer: overview
05200 Pathways in cancer
111763551 (GNG8)
09172 Infectious disease: viral
05170 Human immunodeficiency virus 1 infection
111763551 (GNG8)
05163 Human cytomegalovirus infection
111763551 (GNG8)
05167 Kaposi sarcoma-associated herpesvirus infection
111763551 (GNG8)
09165 Substance dependence
05032 Morphine addiction
111763551 (GNG8)
05034 Alcoholism
111763551 (GNG8)
09180 Brite Hierarchies
09183 Protein families: signaling and cellular processes
04031 GTP-binding proteins [BR:dnm04031]
111763551 (GNG8)
GTP-binding proteins [BR:dnm04031]
Heterotrimeric G-proteins
Gamma Subunits
Gamma [OT]
111763551 (GNG8)
|
SSDB |
|
Motif |
|
Other DBs |
|
LinkDB |
|
Position |
Unknown
|
AA seq |
39 aa
AAAELLAFCEAHAKDDPLVTPVPAAENPFRDKRLFCVLL |
NT seq |
120 nt +upstreamnt +downstreamnt
gcggcggccgagctcctggccttctgcgaggcgcacgccaaggacgacccgctggtgacg
ccggtacccgccgccgagaaccccttccgcgacaagcgcctcttttgcgtcctgctctga |