Desulfotalea psychrophila: DP2169 Help Entry DP2169            CDS       T00192                                  Name (GenBank) probable DNA-binding protein HU   KO K03530   DNA-binding protein HU-beta Organism dps  Desulfotalea psychrophila Brite KEGG Orthology (KO) [BR:dps00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:dps03032]     DP2169    03036 Chromosome and associated proteins [BR:dps03036]     DP2169    03400 DNA repair and recombination proteins [BR:dps03400]     DP2169 DNA replication proteins [BR:dps03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     DP2169 Chromosome and associated proteins [BR:dps03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     DP2169 DNA repair and recombination proteins [BR:dps03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       DP2169 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_2 UBA_HYPK VWA_3 HU-CCDC81_euk_1 Motif Other DBs NCBI-ProteinID:  CAG36898 UniProt:  Q6AL77 LinkDB All DBs Position complement(2490261..2490533) Genome browser AA seq 90 aa AA seqDB search MNKKELIESIADAADISKGAAEKALNGTLAAIAETLKKGDKVTLVGFGTFSVSKREARDG RNPRTNEVIKIPAKNIAKFKAGSKLSEAIN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaacaaaaaggaacttatcgagagtattgcagatgcagccgatatcagcaagggtgcc gctgaaaaagcattgaacggaactttggctgcaattgccgagactttgaagaaaggtgac aaggttactctggtaggctttggaactttttcagtgtctaagcgcgaagctcgtgacgga agaaatccaagaaccaacgaagttattaaaatacctgcgaaaaacattgctaagtttaaa gctggaagcaagctgtccgaggcaattaactaa

DBGET integrated database retrieval system