Desulfohalobium retbaense: Dret_2209 Help Entry Dret_2209         CDS       T00989                                  Name (GenBank) conserved hypothetical protein   KO K09892   cell division protein ZapB Organism drt  Desulfohalobium retbaense Brite KEGG Orthology (KO) [BR:drt00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:drt03036]     Dret_2209 Chromosome and associated proteins [BR:drt03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     Dret_2209 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Filament ZapB YscO EAD9 STAG DUF16 NPV_P10 Tropomyosin Mod_r LRRFIP DUF7310 BAG Herpes_UL6 FAM186A-B_N Prefoldin_2 NYD-SP28_assoc Med21 Snapin_Pallidin Nup54 XhlA Baculo_PEP_C Reovirus_L2_N DUF7260 Med9 HALZ YabA SlyX bZIP_1 Motif Other DBs NCBI-ProteinID:  ACV69493 UniProt:  C8X4Z6 LinkDB All DBs Position complement(2511840..2512028) Genome browser AA seq 62 aa AA seqDB search MTMDNVLTALETKIDALLERVHSLEEHNTSLQRQLDEEREKRGAAVERLDRLLQKLQEVT IE NT seq 189 nt NT seq  +upstreamnt  +downstreamnt atgaccatggataacgtcctgactgccttggagaccaaaatcgacgcccttttggaacgg gtccactccctcgaagagcataacaccagcttgcagcgtcaactcgacgaggaacgagag aagcggggggcggcggttgagagactggatcgcctcttgcaaaaactccaagaggtgact attgagtag

DBGET integrated database retrieval system