Desulfovibrio subterraneus: LN040_03145 Help Entry LN040_03145       CDS       T08953                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism dsb  Desulfovibrio subterraneus Brite KEGG Orthology (KO) [BR:dsb00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:dsb03032]     LN040_03145    03036 Chromosome and associated proteins [BR:dsb03036]     LN040_03145    03400 DNA repair and recombination proteins [BR:dsb03400]     LN040_03145 DNA replication proteins [BR:dsb03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     LN040_03145 Chromosome and associated proteins [BR:dsb03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     LN040_03145 DNA repair and recombination proteins [BR:dsb03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       LN040_03145 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_2 RNA_polI_A14 Motif Other DBs NCBI-ProteinID:  WBF68119 LinkDB All DBs Position complement(704240..704512) Genome browser AA seq 90 aa AA seqDB search MTKADLIEKIAEKANLTKANAERSLNAFIDAVEDVLVKEGKLTLTGFGTFVVEERKERKG RNPRTGAEISIPAAKVVKFRPGKLLKEAIK NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgactaaagcggatctcatcgaaaagattgcagaaaaggcgaacctcaccaaggctaat gccgagcgttcccttaacgccttcatcgacgctgttgaagacgttctggtcaaggaaggc aagctcaccctgaccggtttcggcacttttgttgtcgaagagcgcaaggaacgtaaggga cgcaacccccgtaccggcgcagaaatttccattcccgccgccaaggtggttaagttccgt cccggcaagcttcttaaagaagctatcaagtag

DBGET integrated database retrieval system