Dactylosporangium vinaceum: Dvina_38585 Help Entry Dvina_38585       CDS       T07478                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism dvc  Dactylosporangium vinaceum Pathway dvc00998   Biosynthesis of various antibiotics dvc01100   Metabolic pathways dvc01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:dvc00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Dvina_38585    00074 Mycolic acid biosynthesis     Dvina_38585   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Dvina_38585 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ESX-1_EspG mTERF PP-binding_2 Motif Other DBs NCBI-ProteinID:  UAB94055 LinkDB All DBs Position complement(8626412..8626678) Genome browser AA seq 88 aa AA seqDB search MTRTTSIDRDQVVATIVELLPQVIAADTGAVTEDAKLFDELGLDSTGVLDLMLKIEEELD VEFDTENLQLGHFESVRTLADFVIAEAG NT seq 267 nt NT seq  +upstreamnt  +downstreamnt atgacgcgtaccaccagcatcgaccgcgaccaggtcgtggccaccatcgtcgagctgctg ccccaggtgatcgcggccgacaccggcgcggtgaccgaggacgcgaagctcttcgacgag ctcggcctggactccaccggcgtgctcgacctgatgctgaagatcgaggaggagctcgac gtcgagttcgacaccgagaacctccagctcggccacttcgagtccgtccgcacgctcgcc gacttcgtcatcgccgaggcaggctga

DBGET integrated database retrieval system