Nitratidesulfovibrio vulgaris RCH1: Deval_2460 Help Entry Deval_2460        CDS       T02064                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism dvg  Nitratidesulfovibrio vulgaris RCH1 Brite KEGG Orthology (KO) [BR:dvg00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:dvg03036]     Deval_2460 Chromosome and associated proteins [BR:dvg03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     Deval_2460 SSDB OrthologParalogGFIT Motif Pfam:  ZapB ZapB_rel CCDC162_C ENTR1 ODF2_C DUF3972 HALZ TSC22 FlaC_arch DUF848 CortBP2 UPF0184 OVT1 Tmemb_cc2 bZIP_1 DUF3216 YabA Rab11-FIP3 MIPOL1_N Herpes_BLRF2 CDC37_N DUF3450 Prefoldin SPC25_N FUSC MLKL_N Herpes_UL6 HpsJ Med21 APC_N_CC Snapin_Pallidin Macoilin AFAP_C MTUS1_CCDC69_CC2 Nnf1 Motif Other DBs NCBI-ProteinID:  ADP87603 LinkDB All DBs Position 2783948..2784184 Genome browser AA seq 78 aa AA seqDB search MELLDLLENRVTSLLAQLESLREENRTLREEVDNGLAALAEENRTLKEALEQERSVKDAV LGRIDSLLTTLKDKTGDA NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atggaactgctagacctgctagaaaaccgcgtcacgtcgcttcttgcgcagctcgaatcc ctgcgcgaggaaaaccgcaccctccgagaagaggttgacaatggccttgcggcgttggcc gaagagaatcgtaccctcaaggaagcccttgagcaggaacgcagcgtcaaggatgccgtc ctcggacgcatcgactcgttgctgacaacgctcaaggacaaaactggcgacgcctag

DBGET integrated database retrieval system