Nitratidesulfovibrio vulgaris DP4: Dvul_0587 Help Entry Dvul_0587         CDS       T00452                                  Name (GenBank) conserved hypothetical protein   KO K09892   cell division protein ZapB Organism dvl  Nitratidesulfovibrio vulgaris DP4 Brite KEGG Orthology (KO) [BR:dvl00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:dvl03036]     Dvul_0587 Chromosome and associated proteins [BR:dvl03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     Dvul_0587 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB DUF3972 HALZ TSC22 FlaC_arch DUF848 CortBP2 UPF0184 OVT1 Tmemb_cc2 bZIP_1 DUF3216 Phage_GP20 bHLH_IRO3 YabA Herpes_BLRF2 ATP-synt_D CDC37_N DUF2570 DUF3450 Prefoldin MAD FUSC MLKL_N Med21 APC_N_CC Snapin_Pallidin Macoilin Herpes_UL6 Nnf1 DivIC Motif Other DBs NCBI-ProteinID:  ABM27610 UniProt:  A0A0H3A6B9 LinkDB All DBs Position complement(742479..742715) Genome browser AA seq 78 aa AA seqDB search MELLDLLENRVTSLLAQLESLREENRTLREEVDNGLAALAEENRTLKEALEQERSVKDAV LGRIDSLLTTLKDKTGDA NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atggaactgctagacctgctagaaaaccgcgtcacgtcgcttcttgcgcagctcgaatcc ctgcgcgaggaaaaccgcaccctccgagaagaggttgacaatggccttgcggcgttggcc gaagagaatcgtaccctcaaggaagcccttgagcaggaacgcagcgtcaaggatgccgtc ctcggacgcatcgactcgttgctgacaacgctcaaggacaaaactggcgacgcctag

DBGET integrated database retrieval system