Intestinibaculum porci: SG0102_01430 Help Entry SG0102_01430      CDS       T05736                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ebm  Intestinibaculum porci Pathway ebm01100   Metabolic pathways ebm01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ebm00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     SG0102_01430 (acpP)    00074 Mycolic acid biosynthesis     SG0102_01430 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     SG0102_01430 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  BBH25209 UniProt:  A0A3G9JQ80 LinkDB All DBs Position 144921..145151 Genome browser AA seq 76 aa AA seqDB search MNTFEKVKDIIVDSLSCDENDVTLEASLTDDLEADSLDAVELIMAVEDAFDIEISDEKAS AMKTVKDIVDYVEANA NT seq 231 nt NT seq  +upstreamnt  +downstreamnt atgaatacatttgaaaaggtaaaggatattattgtcgactcattaagctgtgacgaaaat gacgttactttagaagctagcttaacggatgacttagaagcggattctttagatgctgtc gaattaattatggctgttgaagatgcttttgatatcgaaatctctgatgaaaaagcttcc gcaatgaagactgttaaggatatcgttgattacgttgaagcgaacgcttaa

DBGET integrated database retrieval system