Equus caballus (horse): 100314776 Help Entry 100314776         miRNA     T01058                                  Symbol MIR184 Name (RefSeq) eca-miR-184   KO K17177   microRNA 184 Organism ecb  Equus caballus (horse) Brite KEGG Orthology (KO) [BR:ecb00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ecb04147]     100314776 (MIR184)   09184 RNA family    03100 Non-coding RNAs [BR:ecb03100]     100314776 (MIR184) Exosome [BR:ecb04147]  Exosomal RNA   Exosomal RNA of renal carcinoma cells    100314776 (MIR184)   Exosomal RNA of other cancer cells    100314776 (MIR184) Non-coding RNAs [BR:ecb03100]  Small non-coding RNA   Micro RNA    100314776 (MIR184) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100314776 Ensembl:  ENSECAG00000025591 miRBase:  MI0012650 LinkDB All DBs Position 1:complement(116238555..116238624) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tggacggagaactgataagggt

DBGET integrated database retrieval system