Equus caballus (horse): 100314923 Help Entry 100314923         miRNA     T01058                                  Symbol MIR219-2 Name (RefSeq) eca-miR-219-5p   KO K17168   microRNA 219 Organism ecb  Equus caballus (horse) Brite KEGG Orthology (KO) [BR:ecb00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ecb04147]     100314923 (MIR219-2)   09184 RNA family    03100 Non-coding RNAs [BR:ecb03100]     100314923 (MIR219-2) Exosome [BR:ecb04147]  Exosomal RNA   Exosomal RNA of hepatic cancer cells    100314923 (MIR219-2)   Exosomal RNA of lung cancer cells    100314923 (MIR219-2) Non-coding RNAs [BR:ecb03100]  Other eukaryotic RNA   Micro RNA    100314923 (MIR219-2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100314923 Ensembl:  ENSECAG00000025626 miRBase:  MI0012923 LinkDB All DBs Position 25:complement(32252430..32252526) Genome browser NT seq 21 nt NT seq  +upstreamnt  +downstreamnt tgattgtccaaacgcaattct

DBGET integrated database retrieval system