Equus caballus (horse): 100314982 Help Entry 100314982         miRNA     T01058                                  Symbol MIR17 Name (RefSeq) eca-miR-17   KO K17002   microRNA 17 Organism ecb  Equus caballus (horse) Pathway ecb05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:ecb00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100314982 (MIR17)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ecb04147]     100314982 (MIR17)   09184 RNA family    03100 Non-coding RNAs [BR:ecb03100]     100314982 (MIR17) Exosome [BR:ecb04147]  Exosomal RNA   Exosomal RNA of haemopoietic cells    100314982 (MIR17)   Exosomal RNA of breast milk    100314982 (MIR17)   Exosomal RNA of saliva    100314982 (MIR17)   Exosomal RNA of breast cancer cells    100314982 (MIR17)   Exosomal RNA of colorectal cancer cells    100314982 (MIR17)   Exosomal RNA of lung cancer cells    100314982 (MIR17) Non-coding RNAs [BR:ecb03100]  Small non-coding RNA   Micro RNA    100314982 (MIR17) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100314982 Ensembl:  ENSECAG00000026154 miRBase:  MI0012831 LinkDB All DBs Position 17:61685042..61685100 Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt caaagtgcttacagtgcaggtag

DBGET integrated database retrieval system