Equus caballus (horse): 100315021 Help Entry 100315021         miRNA     T01058                                  Symbol MIR204B-2 Name (RefSeq) eca-miR-204b   KO K17166   microRNA 204 Organism ecb  Equus caballus (horse) Brite KEGG Orthology (KO) [BR:ecb00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ecb04147]     100315021 (MIR204B-2)   09184 RNA family    03100 Non-coding RNAs [BR:ecb03100]     100315021 (MIR204B-2) Exosome [BR:ecb04147]  Exosomal RNA   Exosomal RNA of hepatic cancer cells    100315021 (MIR204B-2) Non-coding RNAs [BR:ecb03100]  Other eukaryotic RNA   Micro RNA    100315021 (MIR204B-2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315021 Ensembl:  ENSECAG00000026555 miRBase:  MI0012862 LinkDB All DBs Position 23:19459719..19459786 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt ttccctttgtcatcctatgcct

DBGET integrated database retrieval system