Equus caballus (horse): 100315069 Help Entry 100315069         miRNA     T01058                                  Symbol MIR18A Name (RefSeq) eca-miR-18a   KO K17003   microRNA 18a Organism ecb  Equus caballus (horse) Pathway ecb05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:ecb00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100315069 (MIR18A)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ecb04147]     100315069 (MIR18A)   09184 RNA family    03100 Non-coding RNAs [BR:ecb03100]     100315069 (MIR18A) Exosome [BR:ecb04147]  Exosomal RNA   Exosomal RNA of ovarian cancer cells    100315069 (MIR18A) Non-coding RNAs [BR:ecb03100]  Small non-coding RNA   Micro RNA    100315069 (MIR18A) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315069 Ensembl:  ENSECAG00000025713 miRBase:  MI0012832 LinkDB All DBs Position 17:61685182..61685242 Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt taaggtgcatctagtgcagatag

DBGET integrated database retrieval system