Equus caballus (horse): 100315079 Help Entry 100315079         miRNA     T01058                                  Symbol MIR376A Name (RefSeq) eca-miR-376a   KO K17170   microRNA 376 Organism ecb  Equus caballus (horse) Brite KEGG Orthology (KO) [BR:ecb00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ecb04147]     100315079 (MIR376A)   09184 RNA family    03100 Non-coding RNAs [BR:ecb03100]     100315079 (MIR376A) Exosome [BR:ecb04147]  Exosomal RNA   Exosomal RNA of hepatic cancer cells    100315079 (MIR376A) Non-coding RNAs [BR:ecb03100]  Small non-coding RNA   Micro RNA    100315079 (MIR376A) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315079 miRBase:  MI0012888 LinkDB All DBs Position 24:43350866..43350933 Genome browser NT seq 21 nt NT seq  +upstreamnt  +downstreamnt atcatagaggaaaatccacgt

DBGET integrated database retrieval system