Equus caballus (horse): 100315098 Help Entry 100315098         miRNA     T01058                                  Symbol MIR92A-2 Name (RefSeq) eca-miR-92a   KO K17008   microRNA 92a Organism ecb  Equus caballus (horse) Pathway ecb05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:ecb00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     100315098 (MIR92A-2)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ecb04147]     100315098 (MIR92A-2)   09184 RNA family    03100 Non-coding RNAs [BR:ecb03100]     100315098 (MIR92A-2) Exosome [BR:ecb04147]  Exosomal RNA   Exosomal RNA of breast milk    100315098 (MIR92A-2)   Exosomal RNA of colorectal cancer cells    100315098 (MIR92A-2)   Exosomal RNA of renal carcinoma cells    100315098 (MIR92A-2)   Exosomal RNA of other cancer cells    100315098 (MIR92A-2) Non-coding RNAs [BR:ecb03100]  Small non-coding RNA   Micro RNA    100315098 (MIR92A-2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100315098 Ensembl:  ENSECAG00000025834 miRBase:  MI0012987 LinkDB All DBs Position X:complement(110758524..110758598) Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tattgcacttgtcccggcctgt

DBGET integrated database retrieval system