Enterobacter chengduensis: FY206_15920 Help Entry FY206_15920       CDS       T06229                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism echg  Enterobacter chengduensis Pathway echg01100   Metabolic pathways echg01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:echg00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     FY206_15920    00074 Mycolic acid biosynthesis     FY206_15920   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     FY206_15920 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C Motif Other DBs NCBI-ProteinID:  QEL36803 LinkDB All DBs Position complement(3269531..3269794) Genome browser AA seq 87 aa AA seqDB search MKLDMPVIVDRIKEIIADRIGLDVEREDIADETGLASMVGMDSIGFVELRFQCEEEFNIK VEDKEFSPANFYSCQTLSRFIMNKLGA NT seq 264 nt NT seq  +upstreamnt  +downstreamnt atgaaactggatatgcctgtaattgtcgatcgtattaaagaaattatcgccgaccgtatt ggtctggacgtcgagcgcgaagatattgctgacgagaccggtctcgcctcaatggtagga atggattctattggatttgtagaattacgcttccagtgtgaggaagaatttaatattaaa gttgaagataaagagttttcgcccgcgaatttttattcgtgccaaaccctttcgcgtttc attatgaataagcttggagcctga

DBGET integrated database retrieval system