Entomospira entomophila: PVA45_02720 Help Entry PVA45_02720       CDS       T10561                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism eet  Entomospira entomophila Pathway eet01100   Metabolic pathways eet01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:eet00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     PVA45_02720 (acpP)    00074 Mycolic acid biosynthesis     PVA45_02720 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     PVA45_02720 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding_2 PP-binding dCache_2 Motif Other DBs NCBI-ProteinID:  WDI35985 LinkDB All DBs Position complement(571847..572095) Genome browser AA seq 82 aa AA seqDB search MHTEEELFEELKKIIVSKLKIDDATKVTREARFREDLNADSLDTYDLVYSIEEQMEITIP PEKATDFEKVGDALDFIVSQKK NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atgcacacagaagaagaactttttgaagaactcaaaaaaattatcgtttctaagctaaaa attgatgatgctactaaagttactcgcgaagctcgtttcagagaagacttaaatgcagat agcttggatacttatgaccttgtttattctattgaagaacaaatggaaatcactattcca ccagaaaaggcaactgactttgagaaagttggtgatgctctagactttatcgtttcacaa aagaagtag

DBGET integrated database retrieval system