Effusibacillus dendaii: skT53_01380 Help Entry skT53_01380       CDS       T06872                                  Symbol acpA Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism eff  Effusibacillus dendaii Pathway eff00998   Biosynthesis of various antibiotics eff01100   Metabolic pathways eff01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:eff00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     skT53_01380 (acpA)    00074 Mycolic acid biosynthesis     skT53_01380 (acpA)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     skT53_01380 (acpA) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Motif Other DBs NCBI-ProteinID:  BCJ85153 UniProt:  A0A7I8D4V8 LinkDB All DBs Position 138161..138394 Genome browser AA seq 77 aa AA seqDB search MSVFDTVKKIIVDRLGVDESAVTMEATFKDDLGADSLDVVELVMELEDEFDLEISDEDAE KISSVGEVVRYIESHKA NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgtttttgatacagtcaaaaagattatcgtggaccgtttaggggtcgacgaatct gctgtaaccatggaagcaacgtttaaagatgatctgggcgcagattcgctcgatgtggta gagcttgtaatggagctggaagatgaattcgatctggaaatctccgatgaagatgcggag aaaatcagcagtgtaggggaagtcgtaagatacatagagtcccacaaagcgtaa

DBGET integrated database retrieval system