Enterococcus gallinarum: AL523_06590 Help Entry AL523_06590       CDS       T04148                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism ega  Enterococcus gallinarum Pathway ega01100   Metabolic pathways ega01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:ega00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     AL523_06590 (acpP)    00074 Mycolic acid biosynthesis     AL523_06590 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     AL523_06590 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 TerB Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  AMG49455 LinkDB All DBs Position 1376951..1377193 Genome browser AA seq 80 aa AA seqDB search MTRDEVFKKVAVVIANHFEIDAENVTDTMSIKDDLNADSISVMEFVLELEDEFGTEISDE DAEQIETVGGAVDYISSHLA NT seq 243 nt NT seq  +upstreamnt  +downstreamnt ttgacacgagatgaagtattcaagaaagttgcggtcgtgatcgccaatcattttgaaatt gacgcagagaacgtaacggatacgatgagcattaaagacgacttgaacgctgattcgatc agtgtgatggaattcgtccttgaactagaagatgaatttggtaccgagatttctgatgaa gatgccgagcagatcgaaacagtcggtggagcggttgattatatttcaagccatcttgct taa

DBGET integrated database retrieval system