Duffyella gerundensis: EM595_p0131 Help Entry EM595_p0131       CDS       T04258                                  Name (GenBank) hypothetical protein   KO K21976   probable RcsB/C two-component-system connector, global regulator of biofilm formation and acid-resistance Organism ege  Duffyella gerundensis Brite KEGG Orthology (KO) [BR:ege00001]  09190 Not Included in Pathway or Brite   09193 Unclassified: signaling and cellular processes    99995 Signaling proteins     EM595_p0131 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  YmgB BDM Motif Other DBs NCBI-ProteinID:  CUU25831 UniProt:  A0A0U5LBG9 LinkDB All DBs Position pEM01:130320..130574 Genome browser AA seq 84 aa AA seqDB search MQQQSSEADILEYFKSSGDLYTTETEVLGATIREITAAKGHVTNKAIILHLLAALESSED VLQQDILRSTLELVVGRTPDDSDI NT seq 255 nt NT seq  +upstreamnt  +downstreamnt atgcagcagcagtcatcagaagcagacattctcgaatacttcaaaagcagcggtgatctt tacaccactgaaaccgaagtgctgggcgcgacgattcgcgaaattaccgcagcgaaaggc cacgtcaccaacaaagcgattattttgcatctgttggcagcgctggaaagctccgaggat gtgttgcaacaggatattctgcgcagcacgctggagctggtggttggtcgaacgccggat gacagcgatatctga

DBGET integrated database retrieval system