Embiotoca jacksoni (black perch): 138206576 Help Entry 138206576         CDS       T10523                                  Symbol mt2 Name (RefSeq) metallothionein-2   KO K14739   metallothionein 1/2 Organism eja  Embiotoca jacksoni (black perch) Brite Messenger RNA biogenesis [BR:eja03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      138206576 (mt2) Mitochondrial biogenesis [BR:eja03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     138206576 (mt2) BRITE hierarchy SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  138206576 NCBI-ProteinID:  XP_069019477 LinkDB All DBs Position Unknown AA seq 60 aa AA seqDB search MDPCECSKTGTCNCGGSCTCTNCSCTTCKKSCCACCPSGCTKCASGCVCKGKTCDTSCCQ NT seq 183 nt NT seq  +upstreamnt  +downstreamnt atggatccttgcgagtgctccaagactggaacctgcaactgcggaggatcctgcacatgc accaactgctcctgcaccacctgcaagaagagctgctgcgcctgctgcccatccggctgc accaagtgcgcctctggctgcgtgtgcaaagggaagacgtgcgacaccagctgctgtcag tga

DBGET integrated database retrieval system