Eumetopias jubatus (Steller sea lion): 114204276 Help Entry 114204276         CDS       T07240                                  Name (RefSeq) metallothionein-1-like   KO K14739   metallothionein 1/2 Organism eju  Eumetopias jubatus (Steller sea lion) Pathway eju04978   Mineral absorption Brite KEGG Orthology (KO) [BR:eju00001]  09150 Organismal Systems   09154 Digestive system    04978 Mineral absorption     114204276  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:eju03019]     114204276    03029 Mitochondrial biogenesis [BR:eju03029]     114204276 Messenger RNA biogenesis [BR:eju03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      114204276 Mitochondrial biogenesis [BR:eju03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     114204276 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  114204276 NCBI-ProteinID:  XP_027953210 LinkDB All DBs Position Unknown AA seq 61 aa AA seqDB search MDPNCSCSTGGSCTCAGSCKCKECKCTSCKKSCCSCCPAGCAKCAQGCICKGASDKCSCC A NT seq 186 nt NT seq  +upstreamnt  +downstreamnt atggaccccaactgctcctgctccaccggtggctcctgcacgtgtgccggctcctgcaaa tgcaaggagtgcaaatgcacctcctgcaagaagagctgctgctcctgctgtcccgcgggc tgtgccaagtgtgcccagggctgcatctgcaaaggcgcatcggacaagtgcagttgctgt gcctga

DBGET integrated database retrieval system