Esox lucius (northern pike): 105018493 Help Entry 105018493         CDS       T04894                                  Name (RefSeq) metallothionein   KO K14739   metallothionein 1/2 Organism els  Esox lucius (northern pike) Brite KEGG Orthology (KO) [BR:els00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:els03019]     105018493    03029 Mitochondrial biogenesis [BR:els03029]     105018493 Messenger RNA biogenesis [BR:els03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      105018493 Mitochondrial biogenesis [BR:els03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     105018493 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  105018493 NCBI-ProteinID:  XP_010882273 UniProt:  P25127 LinkDB All DBs Position LG19:26245464..26246518 Genome browser AA seq 60 aa AA seqDB search MDPCECSKTGSCNCGGSCKCSNCACTSCKKSCCSCCPSGCSKCASGCICKGKTCDTSCCQ NT seq 183 nt NT seq  +upstreamnt  +downstreamnt atggatccttgtgaatgctccaaaactggatcttgcaactgtggtggatcctgcaagtgc tctaactgcgcatgcaccagttgtaagaaaagttgctgctcctgctgtccttctggttgc agcaagtgtgcctcaggctgcatatgcaagggcaagacctgtgataccagctgctgtcag tga

DBGET integrated database retrieval system