Escherichia marmotae: C1192_06910 Help Entry C1192_06910       CDS       T05353                                  Name (GenBank) anti-sigma-28 factor FlgM   KO K02398   negative regulator of flagellin synthesis FlgM Organism ema  Escherichia marmotae Pathway ema02020   Two-component system ema02026   Biofilm formation - Escherichia coli ema02040   Flagellar assembly Brite KEGG Orthology (KO) [BR:ema00001]  09130 Environmental Information Processing   09132 Signal transduction    02020 Two-component system     C1192_06910  09140 Cellular Processes   09145 Cellular community - prokaryotes    02026 Biofilm formation - Escherichia coli     C1192_06910   09142 Cell motility    02040 Flagellar assembly     C1192_06910  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02035 Bacterial motility proteins [BR:ema02035]     C1192_06910 Bacterial motility proteins [BR:ema02035]  Flagellar system   Flagellar assembly proteins    Others     C1192_06910 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  FlgM Motif Other DBs NCBI-ProteinID:  AUT26871 UniProt:  A0A2B7MJW3 LinkDB All DBs Position 1296241..1296534 Genome browser AA seq 97 aa AA seqDB search MSIDRTAPLKPISTVQPRETSDTPVANTRSTKTTAAASTSVTLSDAQAKLMQPGSSDINL ERVEALKLAIRNGELKIDVGKIADALISEVQQDLLSK NT seq 294 nt NT seq  +upstreamnt  +downstreamnt atgagtattgaccgcaccgctcccctgaagcccataagcaccgttcagccacgcgaaacc agtgacactccggtagccaatacccgctcgacaaaaacgaccgccgccgccagtaccagt gtgacattaagcgatgcacaagcaaagctgatgcaaccaggcagcagtgatatcaatctt gagcgcgtagaagcgttgaaactggcgattcgtaacggtgaactaaaaatagatgtcggc aaaattgccgatgcactgatcagcgaagtgcaacaagacttactgagtaaataa

DBGET integrated database retrieval system