Enterococcus sp. SB12: RBL01_000480 Help Entry RBL01_000480      CDS       T10850                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism enq  Enterococcus sp. SB12 Pathway enq01100   Metabolic pathways enq01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:enq00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     RBL01_000480 (acpP)    00074 Mycolic acid biosynthesis     RBL01_000480 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     RBL01_000480 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 ACP_SdgA_C Ribosomal_L50 TerB YopA_M Cadherin Arm_3 Motif Other DBs NCBI-ProteinID:  XME79157 LinkDB All DBs Position 87279..87521 Genome browser AA seq 80 aa AA seqDB search MTREEVFNKVAKIISNHFEIDTDKVTDELNIKDDLKADSISIMEFVLELEDEFGTEISDE DAEQIETVGGAVDYISSHLK NT seq 243 nt NT seq  +upstreamnt  +downstreamnt ttgactcgcgaagaagtatttaacaaagtagcgaaaattatttcaaatcattttgagata gataccgataaagtgacggatgaattgaacatcaaagatgatttaaaagctgattcaatt agtattatggaattcgttttagagcttgaagatgaattcggtacggaaatttcagatgaa gatgctgaacaaattgaaacagtcggtggcgcagtagattatatcagcagccatcttaaa taa

DBGET integrated database retrieval system