Candidatus Endoriftia persephonae: L0Y14_04200 Help Entry L0Y14_04200       CDS       T08211                                  Symbol ftsL Name (GenBank) cell division protein FtsL   KO K03586   cell division protein FtsL Organism eps  Candidatus Endoriftia persephonae Brite KEGG Orthology (KO) [BR:eps00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:eps03036]     L0Y14_04200 (ftsL) Chromosome and associated proteins [BR:eps03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     L0Y14_04200 (ftsL) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  FtsL Trep_Strep DUF2275 Motif Other DBs NCBI-ProteinID:  USF88446 UniProt:  A0A9J7A010 LinkDB All DBs Position 926443..926712 Genome browser AA seq 89 aa AA seqDB search MSARSWLLALLMVAVVLSGIGVVYAKYLSRKQFVRLQELLTEREKIGIEWGRLQLEESTL ATHSRVERVARGSLGMHLPRFDEVVVIRR NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgtcggcgcggagctggttgctcgcccttctgatggttgcagtggtgctgtcggggatc ggtgtggtctacgcaaaatacctcagcagaaagcagtttgtgcgtctgcaggagttactg acagagcgggagaagatcggtatcgaatgggggcgtctgcagcttgaggagagcacactc gctacccactcgcgagtggagcgggtagcgcggggcagcctcggcatgcacctgccccgg ttcgatgaagtggtggtgataaggcgctga

DBGET integrated database retrieval system