Candidatus Endoriftia persephonae: L0Y14_15415 Help Entry L0Y14_15415       CDS       T08211                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism eps  Candidatus Endoriftia persephonae Brite KEGG Orthology (KO) [BR:eps00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:eps03036]     L0Y14_15415 Chromosome and associated proteins [BR:eps03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     L0Y14_15415 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB BAR_3 CATRA-C YabA TSC22 DivIC APG6_N DUF16 Mod_r Cluap1 EMP24_GP25L Motif Other DBs NCBI-ProteinID:  USF89270 UniProt:  A0A9J7A2C6 LinkDB All DBs Position 3408274..3408507 Genome browser AA seq 77 aa AA seqDB search MSQNDSINNAEIDLEKLESQVDELIRACTHLSNENKSLRARQESLVAERAALIEKTELAR NRVEAMITRLKSMESTQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgagccagaatgattccatcaacaatgcggaaatcgacttagaaaaactcgaatcccaa gtggacgagctgattcgcgcctgcacccatctgagtaacgagaacaagtccttgcgggcc cgccaggagagcctggttgcagagcgcgctgccctgatcgagaaaactgaactagcacga aacagggtcgaggcaatgatcacccgcctcaaatcgatggaatccacacagtga

DBGET integrated database retrieval system