Aurantiacibacter atlanticus: CP97_04620 Help Entry CP97_04620        CDS       T03997                                  Name (GenBank) peptidoglycan hydrolase   KO K02395   peptidoglycan hydrolase FlgJ Organism ery  Aurantiacibacter atlanticus Pathway ery02040   Flagellar assembly Brite KEGG Orthology (KO) [BR:ery00001]  09140 Cellular Processes   09142 Cell motility    02040 Flagellar assembly     CP97_04620  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02035 Bacterial motility proteins [BR:ery02035]     CP97_04620 Bacterial motility proteins [BR:ery02035]  Flagellar system   Flagellar assembly proteins    Rod and hook     CP97_04620 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Rod-binding Motif Other DBs NCBI-ProteinID:  AKQ41466 UniProt:  A0A0H4VF43 LinkDB All DBs Position complement(942928..943203) Genome browser AA seq 91 aa AA seqDB search MQGGALSTPAAPREDLREAAQAFEAIFIRQLLSSARASDFGGGDLFGGPGLEQFEAMRDE QFADIASQQGTFGLAAAIERQLNAFVDQGGD NT seq 276 nt NT seq  +upstreamnt  +downstreamnt atgcagggcggcgcgctttccaccccagcagccccgcgtgaagatctgcgcgaagcggcg caggcgttcgaggcgatctttatccggcaattgctatcgtctgcgcgcgccagcgatttc ggggggggtgaccttttcggtggccccggtctcgaacagttcgaagccatgcgcgacgag caatttgccgacatcgcctcacagcagggcacatttggcctggccgcggcgatagagcgg cagttgaacgctttcgtcgaccaaggaggcgactag

DBGET integrated database retrieval system