Faecalibacterium wellingii: MTP37_02890 Help Entry MTP37_02890       CDS       T10369                                  Name (GenBank) chemotaxis protein   KO K03116   sec-independent protein translocase protein TatA Organism fah  Faecalibacterium wellingii Pathway fah03060   Protein export fah03070   Bacterial secretion system Brite KEGG Orthology (KO) [BR:fah00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03060 Protein export     MTP37_02890  09130 Environmental Information Processing   09131 Membrane transport    03070 Bacterial secretion system     MTP37_02890  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02044 Secretion system [BR:fah02044]     MTP37_02890 Secretion system [BR:fah02044]  Twin-arginine translocation (Tat) system   Twin-arginine translocation (Tat) pathway protein    MTP37_02890 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Lebercilin Motif Other DBs NCBI-ProteinID:  UQK57082 LinkDB All DBs Position 620486..620767 Genome browser AA seq 93 aa AA seqDB search MGQIKQAKGLESLSRATDTLSTLLAQEVRELNARQKAAKKTGAADGSTIKGLKEATAVLK DLAAVAKTLNDQGTQTEGTGCGVVILPPVEEET NT seq 282 nt NT seq  +upstreamnt  +downstreamnt atggggcagataaaacaggccaaagggctggaaagcctgagccgggccaccgacaccctg agcaccctgctggcgcaggaggtccgggagctgaatgcccgccaaaaggcagcaaagaaa acgggcgcggcagacggcagcaccatcaagggcctcaaggaggccacggcggtgctcaag gatctggccgctgtggccaagaccctgaacgatcagggcacgcagacagagggcacagga tgcggcgtggtgatcctgccgcccgtggaggaagaaacatga

DBGET integrated database retrieval system