Flaviflexus ciconiae: EJ997_05415 Help Entry EJ997_05415       CDS       T05772                                  Name (GenBank) integration host factor   KO K03530   DNA-binding protein HU-beta Organism flh  Flaviflexus ciconiae Brite KEGG Orthology (KO) [BR:flh00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:flh03032]     EJ997_05415    03036 Chromosome and associated proteins [BR:flh03036]     EJ997_05415    03400 DNA repair and recombination proteins [BR:flh03400]     EJ997_05415 DNA replication proteins [BR:flh03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     EJ997_05415 Chromosome and associated proteins [BR:flh03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     EJ997_05415 DNA repair and recombination proteins [BR:flh03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       EJ997_05415 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-DNA_bdg DUF2267 Motif Other DBs NCBI-ProteinID:  AZQ76860 UniProt:  A0A3S9PWV0 LinkDB All DBs Position complement(1197093..1197374) Genome browser AA seq 93 aa AA seqDB search MSLNRTELIAKIAERANLTKTDADSAISALQEVLVESLAAGEAVKITGLMSIERTERAAR KGRNPRTGEEIEIPAGYGVKLSAGSALKKAVSN NT seq 282 nt NT seq  +upstreamnt  +downstreamnt atgtccctgaaccgtaccgagctcattgccaagatcgctgagcgtgcgaacctaaccaag accgatgccgattcggcaatctccgcactccaggaggttctcgttgagtccctcgctgct ggcgaggccgtcaagatcaccggacttatgtcgattgagcgcaccgagcgcgccgcccgc aagggccgcaacccccgtaccggcgaggagatcgagatccccgcaggctacggcgtcaag ctgtcggccggctcggccctgaagaaggctgtctccaactag

DBGET integrated database retrieval system