Fuerstiella marisgermanici: Fuma_04764 Help Entry Fuma_04764        CDS       T04678                                  Symbol acpP_2 Name (GenBank) Acyl carrier protein   KO K02078   acyl carrier protein Organism fmr  Fuerstiella marisgermanici Pathway fmr00998   Biosynthesis of various antibiotics fmr01100   Metabolic pathways fmr01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:fmr00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Fuma_04764 (acpP_2)    00074 Mycolic acid biosynthesis     Fuma_04764 (acpP_2)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Fuma_04764 (acpP_2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Guanylate_cyc Ribosomal_L12_N Motif Other DBs NCBI-ProteinID:  APZ95110 UniProt:  A0A1P8WM34 LinkDB All DBs Position 6329993..6330223 Genome browser AA seq 76 aa AA seqDB search MSVEEKVIDIVSDQLDTPREDIAQSSSFVDDLKADSLDIVELVMALEDEFDIKIPDEDYD KIKTVGDVISYIDNKS NT seq 231 nt NT seq  +upstreamnt  +downstreamnt gtgtccgttgaagaaaaagtcatcgatattgtcagcgatcagctcgacacaccacgcgaa gatattgcccaatccagttctttcgtggacgacctgaaagccgattcactggatattgtc gaattggtcatggctctggaagatgaatttgacatcaaaattccagacgaagactacgat aagatcaagaccgtcggagacgtgatctcgtatatcgacaataagtcttag

DBGET integrated database retrieval system