Frateuria soli: LQ771_00845 Help Entry LQ771_00845       CDS       T08854                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism fsg  Frateuria soli Brite KEGG Orthology (KO) [BR:fsg00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:fsg03036]     LQ771_00845 Chromosome and associated proteins [BR:fsg03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     LQ771_00845 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB DUF7491 Syntaxin Taxilin TSC22 DUF2203 GAS NTR2 Tropomyosin YabA COG3_N Muted KfrA_N FUSC-like Hydro_N_hd DUF3450 Nucleo_P87 Orthopox_A5L Mod_r DUF6092 GatC 5_nucleotid Nuf2_DHR10-like TMF_TATA_bd BRE1 Retinal DUF1515 SKA2 DUF1902 DUF7615 Nup88 DUF4407 DUF2968 UPF0449 bZIP_2 Motif Other DBs NCBI-ProteinID:  UGB38439 LinkDB All DBs Position complement(193887..194111) Genome browser AA seq 74 aa AA seqDB search MSTPDPVQQELATLNQQLDRLLDLVRRLQEENRSLRHSQEQLANERAGLMARNDQARTRV EAMIQRLKALENNG NT seq 225 nt NT seq  +upstreamnt  +downstreamnt atgagcacgcccgatcccgtccagcaggaattggccaccctgaaccagcagctggaccgc ctgctggacctcgtgcgccggctgcaggaggaaaaccgcagcctgcggcacagccaggaa cagctggccaacgagcgggcgggcctgatggcgcgcaacgaccaggcgcgcacgcgcgtc gaggccatgatccaacggttgaaagccctcgagaacaacggctga

DBGET integrated database retrieval system