Frateuria soli: LQ771_00845 Help Entry LQ771_00845       CDS       T08854                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism fsg  Frateuria soli Brite KEGG Orthology (KO) [BR:fsg00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:fsg03036]     LQ771_00845 Chromosome and associated proteins [BR:fsg03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     LQ771_00845 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  ZapB DUF7491 CCDC122 CCDC18_1st Syntaxin Par-4_C TSC22 SPC25_N GAS NTR2 Tropomyosin YabA DUF2203 Muted COG3_N ODF2_N PIBF1 Taxilin KfrA_N Hydro_N_hd Map3k7cl GatC Orthopox_A5L DUF3450 Mod_r CEP131_CC FUSC-like HrpB7 PA2816 HHO5_N 5_nucleotid BRE1 T4SS_LegC2C7 Nuf2_DHR10-like TMF_TATA_bd Retinal DUF1515 SKA2 DUF1902 DUF7615 Nup88 DUF4407 DUF2968 Motif Other DBs NCBI-ProteinID:  UGB38439 LinkDB All DBs Position complement(193887..194111) Genome browser AA seq 74 aa AA seqDB search MSTPDPVQQELATLNQQLDRLLDLVRRLQEENRSLRHSQEQLANERAGLMARNDQARTRV EAMIQRLKALENNG NT seq 225 nt NT seq  +upstreamnt  +downstreamnt atgagcacgcccgatcccgtccagcaggaattggccaccctgaaccagcagctggaccgc ctgctggacctcgtgcgccggctgcaggaggaaaaccgcagcctgcggcacagccaggaa cagctggccaacgagcgggcgggcctgatggcgcgcaacgaccaggcgcgcacgcgcgtc gaggccatgatccaacggttgaaagccctcgagaacaacggctga

DBGET integrated database retrieval system