Gallus gallus (chicken): 777933 Help Entry 777933            miRNA     T01006                                  Symbol MIR92A1 Name (RefSeq) gga-miR-92-5p   KO K17008   microRNA 92 Organism gga  Gallus gallus (chicken) Brite KEGG Orthology (KO) [BR:gga00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:gga04147]     777933 (MIR92A1)   09184 RNA family    03100 Non-coding RNAs [BR:gga03100]     777933 (MIR92A1) Exosome [BR:gga04147]  Exosomal RNA   Exosomal RNA of breast milk    777933 (MIR92A1)   Exosomal RNA of colorectal cancer cells    777933 (MIR92A1)   Exosomal RNA of renal carcinoma cells    777933 (MIR92A1)   Exosomal RNA of other cancer cells    777933 (MIR92A1) Non-coding RNAs [BR:gga03100]  Other eukaryotic RNA   Micro RNA    777933 (MIR92A1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  777933 CGNC:  59213 Ensembl:  ENSGALG00000018248 miRBase:  MI0001179 LinkDB All DBs Position 1:complement(149439848..149439925) Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt aggttgggatcagttgcaatgct

DBGET integrated database retrieval system