Gavialis gangeticus (Gharial): 109288297 Help Entry 109288297         CDS       T07453                                  Symbol CENPX Name (RefSeq) centromere protein X   KO K15360   centromere protein X Organism ggn  Gavialis gangeticus (Gharial) Pathway ggn03460   Fanconi anemia pathway Brite KEGG Orthology (KO) [BR:ggn00001]  09120 Genetic Information Processing   09124 Replication and repair    03460 Fanconi anemia pathway     109288297 (CENPX)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03400 DNA repair and recombination proteins [BR:ggn03400]     109288297 (CENPX) DNA repair and recombination proteins [BR:ggn03400]  Eukaryotic type   DSBR (double strand breaks repair)    FA (Fanconi anemia) pathway     FA core complex binding factors      109288297 (CENPX) BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  CENP-X CBFD_NFYB_HMF SPATS2-like Motif Other DBs NCBI-GeneID:  109288297 NCBI-ProteinID:  XP_019359356 LinkDB All DBs Position Unknown AA seq 82 aa AA seqDB search MEEREEHGAGFRKETVNKLLRRHFRDDRTRVGGEALALLAEMLKVFVREAAVRAARQARA EDLARVDVEHVEKVLPQLLLDF NT seq 249 nt NT seq  +upstreamnt  +downstreamnt atggaggagcgggaagagcacggggccgggttcaggaaggagacggtgaacaagctgctg cgccggcacttccgggacgacaggacgcgcgtgggcggggaggcgctggcgctgctggct gagatgctgaaggtcttcgtgcgagaggccgccgtgcgagctgcccgccaggctcgggcc gaggacctggcgcgggtggacgtcgagcacgtggagaaagtgctgccgcagctgctcctg gacttctag

DBGET integrated database retrieval system