Gossypium hirsutum (upland cotton): 107938411 Help Entry 107938411         CDS       T04793                                  Name (RefSeq) histone H2A-like   KO K11251   histone H2A Organism ghi  Gossypium hirsutum (upland cotton) Pathway ghi03082   ATP-dependent chromatin remodeling Brite KEGG Orthology (KO) [BR:ghi00001]  09120 Genetic Information Processing   09126 Chromosome    03082 ATP-dependent chromatin remodeling     107938411  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:ghi03036]     107938411   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:ghi04147]     107938411 Chromosome and associated proteins [BR:ghi03036]  Eukaryotic type   Nucleosome assembly factors    Histones     107938411 Exosome [BR:ghi04147]  Exosomal proteins   Exosomal proteins of haemopoietic cells  (B-cell, T-cell, DC-cell, reticulocyte, and mast cell)    107938411 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Histone_H2A_C Histone Motif Other DBs NCBI-GeneID:  107938411 NCBI-ProteinID:  XP_016727047 UniProt:  A0A1U8MJR1 LinkDB All DBs Position A08:complement(280811..281229) Genome browser AA seq 98 aa AA seqDB search TENAPVYLAAVLEYLAAEVLELSGNVVRDNKKNNIIPRYVLLAVRNDEELGKLLVGVTIA LGGVLPNINLVLLPKKTEKAAGKEPKSPSKAIKSPNKG NT seq 297 nt NT seq  +upstreamnt  +downstreamnt actgaaaatgccccagtttacttggctgcagttcttgagtacttggccgcagaggttttg gaattgtctgggaacgttgtacgtgacaacaagaaaaacaatatcataccaaggtacgtg ctactcgccgtgaggaatgacgaagaattagggaagcttctcgttggcgtaaccatcgct cttggtggtgtgttgccgaatatcaacctagttcttttgccgaagaagactgaaaaggcc gctggcaaagaacccaaatctccatcaaaggctatcaagtctcctaataaaggttaa

DBGET integrated database retrieval system