Halomonas sp. DN3: NKF27_11505 Help Entry NKF27_11505       CDS       T10930                                  Name (GenBank) hypothetical protein   KO K03746   DNA-binding protein H-NS Organism hadn  Halomonas sp. DN3 Brite KEGG Orthology (KO) [BR:hadn00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:hadn03036]     NKF27_11505    03400 DNA repair and recombination proteins [BR:hadn03400]     NKF27_11505 Chromosome and associated proteins [BR:hadn03036]  Prokaryotic type   Nucleoid associated proteins    HNS (histone-like nucleoid structuring protein)     NKF27_11505 DNA repair and recombination proteins [BR:hadn03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHDIR (short-homology-dependent illegitimate recombination)      Supressor       NKF27_11505 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Histone_HNS_N SPT2_N Utp13 AT_hook DUF6374 PRCC Allexi_40kDa GCIP_C DUF7198 MCR_C 5_3_exonuc T7_gp14 DUF6353 GNAT_acetyltr_2 DUF444 5_nucleotid Motif Other DBs NCBI-ProteinID:  USZ48155 LinkDB All DBs Position complement(2662912..2663196) Genome browser AA seq 94 aa AA seqDB search MSSESLERIARNKNVARAAARQLSMEQLQKLAEVVEEVIDQKRDEERQRQEEEMQKAQKL AEIREQITEAGLSLDDLVSEQPKRKRGRPPKNAK NT seq 285 nt NT seq  +upstreamnt  +downstreamnt atgtccagcgaatcattggaacgcattgcgagaaacaagaacgtggcacgggcagcggct cgtcaactgagcatggaacagctgcaaaaactggcggaagtggtcgaggaggtcatcgat cagaagcgcgacgaggagcgccagcgccaggaagaagagatgcagaaggcccagaagctg gcggagatccgtgagcagatcaccgaagccggcctgtcgctggatgatctcgtatcggag cagcccaagcgcaagcgtggacgtccgcccaagaacgccaagtaa

DBGET integrated database retrieval system