Natronosalvus halobius: NGM15_15825 Help Entry NGM15_15825       CDS       T08721                                  Name (GenBank) 30S ribosomal protein S27ae   KO K02977   ubiquitin-small subunit ribosomal protein S27Ae Organism halv  Natronosalvus halobius Pathway halv03010   Ribosome Brite KEGG Orthology (KO) [BR:halv00001]  09120 Genetic Information Processing   09122 Translation    03010 Ribosome     NGM15_15825   09123 Folding, sorting and degradation    04120 Ubiquitin mediated proteolysis     NGM15_15825  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03011 Ribosome [BR:halv03011]     NGM15_15825    04121 Ubiquitin system [BR:halv04121]     NGM15_15825   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:halv04147]     NGM15_15825 Ribosome [BR:halv03011]  Ribosomal proteins   Eukaryotes    Small subunit     NGM15_15825   Archaea     NGM15_15825 Ubiquitin system [BR:halv04121]  Ubiquitins and ubiquitin-like proteins   Ubiquitins    NGM15_15825 Exosome [BR:halv04147]  Exosomal proteins   Exosomal proteins of haemopoietic cells  (B-cell, T-cell, DC-cell, reticulocyte, and mast cell)    NGM15_15825   Exosomal proteins of colorectal cancer cells    NGM15_15825 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Ribosomal_S27 FYVE Zn_Ribbon_TF Ribosomal_L37e Zn_ribbon_RPB9 zf-C2H2_FBX41 Zn_ribbon_3 DZR_2 Cas12f1-like_TNB Anti-TRAP DUF7575 HypA Zn_ribbon_16 DUF5817 Zn_ribbon_TFIIB Motif Other DBs NCBI-ProteinID:  USZ71511 LinkDB All DBs Position 3268822..3268956 Genome browser AA seq 44 aa AA seqDB search MAHYELYNDEGEVEREQCPRCGDSFLADHGDRQHCGKCGYTEWA NT seq 135 nt NT seq  +upstreamnt  +downstreamnt atggcacactacgaactctacaacgacgagggcgaagtcgaacgcgaacagtgcccgcgc tgtggtgactcgttcctcgccgaccacggcgaccgccagcactgtggcaagtgcggctac accgagtgggcgtaa

DBGET integrated database retrieval system