Halomonas beimenensis: BEI_1644 Help Entry BEI_1644          CDS       T05125                                  Name (GenBank) hypothetical protein   KO K03746   DNA-binding protein H-NS Organism hbe  Halomonas beimenensis Brite KEGG Orthology (KO) [BR:hbe00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:hbe03036]     BEI_1644    03400 DNA repair and recombination proteins [BR:hbe03400]     BEI_1644 Chromosome and associated proteins [BR:hbe03036]  Prokaryotic type   Nucleoid associated proteins    HNS (histone-like nucleoid structuring protein)     BEI_1644 DNA repair and recombination proteins [BR:hbe03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHDIR (short-homology-dependent illegitimate recombination)      Supressor       BEI_1644 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Histone_HNS_N DUF6374 Utp13 SPT2_N 5_3_exonuc MerR-DNA-bind Motif Other DBs NCBI-ProteinID:  ATJ82631 UniProt:  A0A291P703 LinkDB All DBs Position 1721818..1722111 Genome browser AA seq 97 aa AA seqDB search MSDHTLERIARNKNVARAAARQLSMEQLHKLAEVIGEVIEQKNDEERKRQEEEALKARKL AEIREQINEAGLSIDDLVPEQPKRKRGRPPKKKAAEE NT seq 294 nt NT seq  +upstreamnt  +downstreamnt atgtccgaccacaccctggagcgtatcgctcgcaacaagaacgtggcccgcgcggcggcc cgtcaactcagcatggagcaactccacaagctggccgaggtgatcggcgaagtcatcgag cagaagaacgatgaggagcgcaagcgccaggaagaggaagccctcaaggcccgcaagctc gccgagattcgcgagcagatcaacgaggccggcctgtcgatcgacgacctggtacccgag caacccaagcgcaagcgcggtcgcccgccgaagaagaaggccgccgaggagtag

DBGET integrated database retrieval system