Hyperthermus butylicus: Hbut_1603 Help Entry Hbut_1603         CDS       T00468                                  Name (GenBank) hypothetical protein   KO K07342   protein transport protein SEC61 subunit gamma and related proteins Organism hbu  Hyperthermus butylicus Pathway hbu03060   Protein export hbu04141   Protein processing in endoplasmic reticulum Brite KEGG Orthology (KO) [BR:hbu00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03060 Protein export     Hbut_1603    04141 Protein processing in endoplasmic reticulum     Hbut_1603  09140 Cellular Processes   09141 Transport and catabolism    04145 Phagosome     Hbut_1603  09180 Brite Hierarchies   09182 Protein families: genetic information processing    04131 Membrane trafficking [BR:hbu04131]     Hbut_1603   09183 Protein families: signaling and cellular processes    02044 Secretion system [BR:hbu02044]     Hbut_1603 Membrane trafficking [BR:hbu04131]  Endoplasmic reticulum (ER) - Golgi transport   Others    SEC61 complex     Hbut_1603 Secretion system [BR:hbu02044]  Sec (secretion) system   Eukaryotic Sec-SRP protein    Hbut_1603 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  SecE Motif Other DBs NCBI-ProteinID:  ABM81422 UniProt:  A2BN61 LinkDB All DBs Position 1606000..1606209 Genome browser AA seq 69 aa AA seqDB search MASKERESSGPLGYIRMALHEWRLILQRVRKPDREEYIHTAKIIWLAILLVGSVAYVIHL VATQVVMGG NT seq 210 nt NT seq  +upstreamnt  +downstreamnt atggctagcaaggagcgagaaagcagcggccccctaggctacataaggatggcactacac gagtggaggctcatacttcagcgcgtaaggaagcctgatcgcgaggagtacatacacacg gccaagataatatggctagctatactgcttgtaggctctgtagcttatgtcatacacctc gtcgctacacaagtggtaatggggggctag

DBGET integrated database retrieval system