Halomonas elongata: HELO_2976 Help Entry HELO_2976         CDS       T01311                                  Name (GenBank) H-NS domain protein   KO K03746   DNA-binding protein H-NS Organism hel  Halomonas elongata Brite KEGG Orthology (KO) [BR:hel00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:hel03036]     HELO_2976    03400 DNA repair and recombination proteins [BR:hel03400]     HELO_2976 Chromosome and associated proteins [BR:hel03036]  Prokaryotic type   Nucleoid associated proteins    HNS (histone-like nucleoid structuring protein)     HELO_2976 DNA repair and recombination proteins [BR:hel03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHDIR (short-homology-dependent illegitimate recombination)      Supressor       HELO_2976 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Histone_HNS_N DUF6374 Utp13 AT_hook SPT2_N polyprenyl_synt Allexi_40kDa RMP1 Reovirus_M2 5_3_exonuc HEAT_Ints3_C CR6_interact Motif Other DBs NCBI-ProteinID:  CBV42860 UniProt:  E1V431 LinkDB All DBs Position complement(2323393..2323692) Genome browser AA seq 99 aa AA seqDB search MSNQTLERIARNKNVARAAARQLSMEQLHKLAEVIGEVIEQKNDEEKRRQEEEAQKARKL AEIREQINEAGLSIDDLVPDQPKRKRGRPPKNAKDADKA NT seq 300 nt NT seq  +upstreamnt  +downstreamnt atgtccaatcaaaccctggagcgaatcgctcgaaacaagaatgtggcacgcgcagcggct cgccagttgagcatggaacaactgcacaaactggccgaggtgatcggcgaggtgatcgag cagaagaacgacgaggaaaagcgccgtcaggaagaagaggcgcaaaaggcgcgcaagctt gcggaaattcgcgagcaaatcaatgaagccggtctttccattgatgacctggtgcccgat cagcccaagcgcaagcgtgggcgtccgccgaagaatgccaaggatgccgacaaggcatga

DBGET integrated database retrieval system