Hermetia illucens (black soldier fly): 119661390 Help Entry 119661390         CDS       T08287                                  Name (RefSeq) protein dpy-30 homolog   KO K14965   protein dpy-30 Organism his  Hermetia illucens (black soldier fly) Brite KEGG Orthology (KO) [BR:his00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:his03036]     119661390 Chromosome and associated proteins [BR:his03036]  Eukaryotic type   Histone modification proteins    HMT complexes     COMPASS/SET1 complex      119661390     MLL-HCF complex      119661390     MLL3/MLL4 complex      119661390 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Dpy-30 RIIa Motif Other DBs NCBI-GeneID:  119661390 NCBI-ProteinID:  XP_037926641 LinkDB All DBs Position 1:162337782..162338622 Genome browser AA seq 78 aa AA seqDB search MSTTEKPETQPTPQQPKKARTDLQSLPTRQYLDQTVAPILLQGLQTLARERPPDPVSFLA SYLMKNKGRCEDTPTENS NT seq 237 nt NT seq  +upstreamnt  +downstreamnt atgtccacaacagagaaacctgaaacgcagccaactccgcaacagccgaaaaaggctcgg acggacttacaatcactgcccacacgacagtacctagaccaaaccgtagcgcctatcctc ctccaaggcctgcaaacactagcccgcgagcggccaccggatccagtcagtttcctagcc tcgtatttgatgaaaaataaaggacggtgcgaggacacgccgacggaaaactcatga

DBGET integrated database retrieval system