Billgrantia tianxiuensis: EKK97_02830 Help Entry EKK97_02830       CDS       T08051                                  Symbol zapB Name (GenBank) cell division protein ZapB   KO K09892   cell division protein ZapB Organism htx  Billgrantia tianxiuensis Brite KEGG Orthology (KO) [BR:htx00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:htx03036]     EKK97_02830 (zapB) Chromosome and associated proteins [BR:htx03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     EKK97_02830 (zapB) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Nuf2_DHR10-like YabA Leu_zip Tup_N CCDC113_CCDC96_CC GAS CCDC138_cc FliD_C DegS DivIC RH1 XRCC4_CC Motif Other DBs NCBI-ProteinID:  QHC48751 UniProt:  A0A6I6SH79 LinkDB All DBs Position complement(615240..615431) Genome browser AA seq 63 aa AA seqDB search MSTELFNRLEQKVASAVEALELLKLEAEELREENSRLKQEREEWERRLTALLGKFDEVET ERA NT seq 192 nt NT seq  +upstreamnt  +downstreamnt atgagcaccgaactcttcaaccggctcgaacagaaagtggccagtgccgtcgaggccctg gaactgctgaagctggaagccgaggagctgcgcgaggaaaacagccgcctgaagcaggag cgcgaggagtgggagcgccgtctgacggctctgttgggcaagttcgacgaggtggaaacc gagcgagcctga

DBGET integrated database retrieval system