Ictalurus furcatus (blue catfish): 26118490 Help Entry 26118490          CDS       T09387                                  Symbol ND4L, ASK68_gp05 Name (RefSeq) NADH dehydrogenase subunit 4L   KO K03882   NADH-ubiquinone oxidoreductase chain 4L [EC:7.1.1.2] Organism ifu  Ictalurus furcatus (blue catfish) Pathway ifu00190   Oxidative phosphorylation ifu01100   Metabolic pathways Module ifu_M00142   NADH:ubiquinone oxidoreductase, mitochondria Brite KEGG Orthology (KO) [BR:ifu00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     26118490 (ND4L)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03029 Mitochondrial biogenesis [BR:ifu03029]     26118490 (ND4L) Enzymes [BR:ifu01000]  7. Translocases   7.1  Catalysing the translocation of protons    7.1.1  Linked to oxidoreductase reactions     7.1.1.2  NADH:ubiquinone reductase (H+-translocating)      26118490 (ND4L) Mitochondrial biogenesis [BR:ifu03029]  Mitochondrial DNA transcription, translation, and replication factors   Mitochondrial DNA-encoded proteins    Mitochondrial respiratory chain complex I     26118490 (ND4L) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Oxidored_q2 Motif Other DBs NCBI-GeneID:  26118490 NCBI-ProteinID:  YP_009175347 UniProt:  A0A0N7ATH9 LinkDB All DBs Position MT:10047..10343 Genome browser AA seq 98 aa AA seqDB search MTPAYFSFASAFTLGLTGLAFHRTHLLSALLCLEGMMLSLFIALALWMLQLESTAFSAAP ILLLAFSACEAGAGLALLVATARTHGTDRLQSLNLLQC NT seq 297 nt NT seq  +upstreamnt  +downstreamnt atgactcctgcctacttcagcttcgcctccgcatttacactaggacttacaggactagca ttccaccgcacccacctgctttcagccctactatgcttagagggcataatactgtcttta tttattgccctggccctatgaatactacagctagaatccactgccttctctgccgccccc attctcctactagctttttcagcctgtgaagctggtgcaggcttagccctactagttgcc acagcccgaacccatggcacagaccgtctacaatccttaaacctactacaatgctaa

DBGET integrated database retrieval system