Iodobacter ciconiae: EJO50_13075 Help Entry EJO50_13075       CDS       T05767                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism iod  Iodobacter ciconiae Brite KEGG Orthology (KO) [BR:iod00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:iod03036]     EJO50_13075 Chromosome and associated proteins [BR:iod03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     EJO50_13075 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Csm1_N NUDE_C Atg11_middle Motif Other DBs NCBI-ProteinID:  AZN37334 UniProt:  A0A3S8ZV93 LinkDB All DBs Position complement(2988136..2988336) Genome browser AA seq 66 aa AA seqDB search MEAELLNLEDKVAQLALLCRRLRDENRGLRQKLLLTQQQNQGLLAKVDGSKERVAAILAK LPEDTE NT seq 201 nt NT seq  +upstreamnt  +downstreamnt atggaagctgaactgttaaatcttgaagacaaagtagctcagttagcgctgctttgccgt aggttacgcgatgaaaatcgtggcttgcgtcagaaattattgctgacacagcagcaaaat cagggcttgctggcaaaagtagatggaagcaaagaaagagttgctgctattttagctaag ctgccggaggatacagaatga

DBGET integrated database retrieval system