Streptomyces sp. NL15-2K: Q4V64_44880 Help Entry Q4V64_44880       CDS       T09250                                  Name (GenBank) ferredoxin   KO K24530   ferredoxin Organism kbu  Streptomyces sp. NL15-2K Pathway kbu01100   Metabolic pathways kbu01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:kbu00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    00522 Biosynthesis of 12-, 14- and 16-membered macrolides     Q4V64_44880  09180 Brite Hierarchies   09181 Protein families: metabolism    01008 Polyketide biosynthesis proteins [BR:kbu01008]     Q4V64_44880 Polyketide biosynthesis proteins [BR:kbu01008]  Nonribosomal peptide tailoring proteins   Others    Q4V64_44880 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Fer4_13 Fer4_15 Motif Other DBs NCBI-ProteinID:  WKX14274 LinkDB All DBs Position complement(10294880..10295080) Genome browser AA seq 66 aa AA seqDB search MGSRIHINDNCLGIGACEAVAPHLFAVRDGTAELLINDPAAIDIELARDAIDACPMLAIE ATEVDQ NT seq 201 nt NT seq  +upstreamnt  +downstreamnt atgggatctcggatccacataaacgacaactgccttggcatcggtgcatgcgaggcggtc gcaccacacctctttgctgtccgcgacggaaccgcggagctgctcatcaatgatccggct gcgatcgatatcgaactggcccgggatgccatcgacgcgtgtcccatgcttgccatcgag gccaccgaggtcgaccagtga

DBGET integrated database retrieval system