Klebsiella michiganensis KCTC 1686: KOX_00300 Help Entry KOX_00300         CDS       T01681                                  Name (GenBank) hypothetical protein   KO K02196   heme exporter protein D Organism kox  Klebsiella michiganensis KCTC 1686 Pathway kox02010   ABC transporters Brite KEGG Orthology (KO) [BR:kox00001]  09130 Environmental Information Processing   09131 Membrane transport    02010 ABC transporters     KOX_00300  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02000 Transporters [BR:kox02000]     KOX_00300 Transporters [BR:kox02000]  ABC transporters, prokaryotic type   ABC-2 type and other transporters    Heme transporter     KOX_00300 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  CcmD Motif Other DBs NCBI-ProteinID:  AEX01807 UniProt:  A0A0H3H0B4 LinkDB All DBs Position complement(72625..72828) Genome browser AA seq 67 aa AA seqDB search MSSAFTSWSDFLAMGGYAFYVWLAVALTVLPLAALVAHSAILHRVILRDIARQRAREARR RAAREAT NT seq 204 nt NT seq  +upstreamnt  +downstreamnt atgagcagcgcatttacaagctggagtgatttcctggccatgggcggctatgccttttat gtctggctggcggtggcgctgaccgttcttccgctggcggcgctggtcgcgcacagcgcg atcctgcatcgtgtcattctgcgcgatatcgcccggcagcgcgcccgtgaagcccgcagg cgcgcggcgcgggaggcgacatga

DBGET integrated database retrieval system