Lysobacter capsici: LC55x_0997 Help Entry LC55x_0997        CDS       T04162                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism lcp  Lysobacter capsici Brite KEGG Orthology (KO) [BR:lcp00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:lcp03036]     LC55x_0997 Chromosome and associated proteins [BR:lcp03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     LC55x_0997 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB bZIP_1 GAS DUF7491 COG3_N Herpes_BLRF2 DUF7603 HAP1_N SKA2 YabA TSC22 APG6_N Taxilin CENP-F_leu_zip bZIP_2 DUF3450 Tropomyosin DUF2205 Mod_r Syntaxin DivIC SOGA Asd-4 DUF2203 Seryl_tRNA_N TMF_DNA_bd APH FUSC FapA Nup88 Motif Other DBs NCBI-ProteinID:  ALN84289 LinkDB All DBs Position complement(1113961..1114182) Genome browser AA seq 73 aa AA seqDB search MERAELLAELQSLLARVDELGDRVRKLSDENRSLRQQQEQLVGERSALLAKNEQARTRVE AMIARLKSLEQHT NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atggaacgcgccgaactactcgccgaattgcagtcgctgcttgcccgcgtcgacgagctc ggcgaccgcgtgcgcaaactcagcgacgagaaccgcagcctgcgccagcagcaggaacaa ctggtcggcgaacgctcggccctgctggccaagaacgagcaggcgcgcacccgcgtcgag gccatgatcgcgcgactcaagtcgctggagcagcacacgtga

DBGET integrated database retrieval system