Leucoraja erinaceus (little skate): 129697797 Help Entry 129697797         CDS       T09122                                  Name (RefSeq) metallothionein-1-like   KO K14739   metallothionein 1/2 Organism leri  Leucoraja erinaceus (little skate) Brite KEGG Orthology (KO) [BR:leri00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:leri03019]     129697797    03029 Mitochondrial biogenesis [BR:leri03029]     129697797 Messenger RNA biogenesis [BR:leri03019]  Eukaryotic type   mRNA surveillance and transport factors    Factors involved in mRNA localization     Factors that have mRNA localization signals      129697797 Mitochondrial biogenesis [BR:leri03029]  Mitochondrial quality control factors   Regulator of mitochondrial biogenesis    Nuclear respiratory factors     129697797 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Metallothio Motif Other DBs NCBI-GeneID:  129697797 NCBI-ProteinID:  XP_055492398 LinkDB All DBs Position 6:29455378..29455828 Genome browser AA seq 62 aa AA seqDB search MSDAPCTCNQGGPCSCGDNCKCKDCKCTSCKKSCCSCCPAGCSKCAQGCACKGAGDKGSC CH NT seq 189 nt NT seq  +upstreamnt  +downstreamnt atgtctgatgctccatgcacatgtaaccagggcggcccctgttcctgcggggacaactgt aaatgcaaagactgcaaatgcacttcgtgtaagaagagctgctgctcctgttgccccgca ggttgcagcaaatgcgcccaaggctgcgcctgcaaaggcgccggcgacaagggcagctgc tgccactga

DBGET integrated database retrieval system